Top » Catalog » SNPs » YP6009

$18.00

YP6009
[YP6009]

YP6009
hg38 Position: ChrY:16667871..16667871
Ancestral: C
Derived: T
Reference: Kudryashov Klinushin (2017)
ISOGG Haplogroup: R1a
Comments: Below Y33
Forward Primer: YP6009_F CTCCTGACCTCAAGCAATCC
Reverse Primer: YP6009_R TTCAGCTGGATTTGAGCAAG
Reviews

Customers who bought this product also purchased
M458
M458
Y2902
Y2902
YP5919
YP5919
Z91
Z91
S18681
S18681
YP968
YP968
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies