Top » Catalog » SNPs » YP6009

$18.00

YP6009
[YP6009]

YP6009
hg38 Position: ChrY:16667871..16667871
Ancestral: C
Derived: T
Reference: Kudryashov Klinushin (2017)
ISOGG Haplogroup: R1a
Comments: Below Y33
Forward Primer: YP6009_F CTCCTGACCTCAAGCAATCC
Reverse Primer: YP6009_R TTCAGCTGGATTTGAGCAAG
Reviews

Customers who bought this product also purchased
CTS8816
CTS8816
R1a Superclade Panel
R1a Superclade Panel
CTS1211
CTS1211
FGC19283
FGC19283
R1a-Z280 Panel
R1a-Z280 Panel
L1280
L1280
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies