Top » Catalog » SNPs » YP6009

$18.00

YP6009
[YP6009]

YP6009
hg38 Position: ChrY:16667871..16667871
Ancestral: C
Derived: T
Reference: Kudryashov Klinushin (2017)
ISOGG Haplogroup: R1a
Comments: Below Y33
Forward Primer: YP6009_F CTCCTGACCTCAAGCAATCC
Reverse Primer: YP6009_R TTCAGCTGGATTTGAGCAAG
Reviews

Customers who bought this product also purchased
Z93
Z93
BY3301
BY3301
CTS8816
CTS8816
R1a Superclade Panel
R1a Superclade Panel
CTS1211
CTS1211
FGC19283
FGC19283
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies