Top » Catalog » SNPs » Y920

$19.00

Y920
[Y920]

Y920
hg38 Position: ChrY:13640861..13640861
Ancestral: T
Derived: C
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a1 (not listed)
Comments: Below Y6 > Y5
Forward Primer: Y920_F GGGCCTTAAGACATAGGACTCC
Reverse Primer: Y920_R CATACCTTCCAGACAAACCTTG
Reviews

Customers who bought this product also purchased
FT189252
FT189252
M9
M9
Y244031
Y244031
Y27556
Y27556
YP6053
YP6053
M267
M267
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies