Top » Catalog » SNPs » FGC32449

$18.00

FGC32449
[FGC32449]

FGC32449
HG19 Position: ChrY:10220285..10220285
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b1a1a1
Comments: Below S744 > S764 > S760
Forward Primer: FGC32449_F GAATGCACACATCACAAGGAG
Reverse Primer: FGC32449_R TCTCTGTTTTGGTACCAGTACCG
Reviews

Customers who bought this product also purchased
S744
S744
A33
A33
FGC23770
FGC23770
FGC28987
FGC28987
DF13
DF13
A718
A718
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies