Top » Catalog » SNPs » FGC32449

$18.00

FGC32449
[FGC32449]

FGC32449
hg38 Position: ChrY:10220285..10220285
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b1a1a1
Comments: Below S744 > S764 > S760
Forward Primer: FGC32449_F GAATGCACACATCACAAGGAG
Reverse Primer: FGC32449_R TCTCTGTTTTGGTACCAGTACCG
Reviews

Customers who bought this product also purchased
S760
S760
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies