Top » Catalog » SNPs » FGC4342

$18.00

FGC4342
[FGC4342]

FGC4342
hg38 Position: ChrY:8939137..8939137
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC9 > FGC4340
Forward Primer: FGC4342_F GCACCAATCTGCACTCTGG
Reverse Primer: FGC4342_R GCGTTTACAATCCCTGAGCTATAC
Reviews

Customers who bought this product also purchased
FGC4353
FGC4353
ZS7106
ZS7106
M267
M267
ZS7103
ZS7103
ZS5809
ZS5809
FGC4355
FGC4355
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies