Top » Catalog » SNPs » FGC4342

$18.00

FGC4342
[FGC4342]

FGC4342
HG19 Position: ChrY:8807178..8807178
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: unknown
Comments:
Forward Primer: FGC4342_F GCACCAATCTGCACTCTGG
Reverse Primer: FGC4342_R GCGTTTACAATCCCTGAGCTATAC
Reviews

Customers who bought this product also purchased
FGC4353
FGC4353
ZS7103
ZS7103
ZS5809
ZS5809
FGC4355
FGC4355
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC4340
FGC4340
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14637
1 x HVR2
1 x mtComplete
1 x HVR1
$247.00
Haplogroup Info
Other products
Currencies