Top » Catalog » SNPs » FGC4342

$18.00

FGC4342
[FGC4342]

FGC4342
hg38 Position: ChrY:8939137..8939137
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC9 > FGC4340
Forward Primer: FGC4342_F GCACCAATCTGCACTCTGG
Reverse Primer: FGC4342_R GCGTTTACAATCCCTGAGCTATAC
Reviews

Customers who bought this product also purchased
FGC4353
FGC4353
L858
L858
FGC39175
FGC39175
FGC1721
FGC1721
ZS7106
ZS7106
M267
M267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies