Top » Catalog » SNPs » S760

$18.00

S760
[S760]

S760
HG19 Position: ChrY:17367469..17367469
Ancestral: G
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b
Comments: Below S744 > S764 > S756
Forward Primer: S760_F CAGGAGGTCACCACCAGATG
Reverse Primer: S760_R TTTAGTATAGTTAGCTTTTCTTGTTGCC
Reviews

Customers who bought this product also purchased
FGC32449
FGC32449
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies