Top » Catalog » SNPs » Z724

$18.00

Z724
[Z724]

Z724
hg38 Position: ChrY:6967504..6967504
Ancestral: C
Derived: T
Reference: Ray Banks (2011)
ISOGG Haplogroup: G2a2b2a1a1c1
Comments: downstream from L140. parallel to U1 and L497 and upstream from L640
Forward Primer: Z724_F CTACAGCTGCAGCACAGACC
Reverse Primer: Z724_R CCAATTGCTGGAGAGAGAGC
Reviews

Customers who bought this product also purchased
FGC37725
FGC37725
FGC12126
FGC12126
Z6028
Z6028
U8
U8
FGC31715
FGC31715
FGC251
FGC251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies