Top » Catalog » SNPs » A7314

$18.00

A7314
[A7314]

A7314
hg38 Position: ChrY:13867437..13867437
Ancestral: A
Derived: C
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF13 > S16264
Forward Primer: A7314_F TTGAAAGGCTGTTGTGAAGGTC
Reverse Primer: A7314_R CTGCATTCTCCTTTTTTATTGCC
Reviews

Customers who bought this product also purchased
FGC59869
FGC59869
A16005
A16005
A16004
A16004
A7313
A7313
FGC59880
FGC59880
R1b-S16264 Turner Panel
R1b-S16264 Turner Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies