Top » Catalog » SNPs » BY10527

$18.00

BY10527
[BY10527]

BY10527
hg38 Position: ChrY:16812907..16812907
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1e1a3~
Comments: Downstream E-F1382 > Y6198
Forward Primer: BY10527_F TCAATGCATGTTTTTCTACGTG
Reverse Primer: BY10527_R AGTGGCTCACGCCTGTAATC
Reviews

Customers who bought this product also purchased
L795
L795
Y157539
Y157539
Y6968
Y6968
Y6200
Y6200
PF6748
PF6748
FGC45218
FGC45218
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies