Top » Catalog » SNPs » BY10527

$18.00

BY10527
[BY10527]

BY10527
hg38 Position: ChrY:16812907..16812907
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1e1a3~
Comments: Downstream E-F1382 > Y6198
Forward Primer: BY10527_F TCAATGCATGTTTTTCTACGTG
Reverse Primer: BY10527_R AGTGGCTCACGCCTGTAATC
Reviews

Customers who bought this product also purchased
Z834
Z834
PF6751
PF6751
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Y29430
Y29430
L335
L335
PF6748
PF6748
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies