Top » Catalog » SNPs » BY10527

$18.00

BY10527
[BY10527]

BY10527
hg38 Position: ChrY:16812907..16812907
Ancestral: G
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b1b1b2a1a1a1a1e1a3~
Comments: Downstream E-F1382 > Y6198
Forward Primer: BY10527_F TCAATGCATGTTTTTCTACGTG
Reverse Primer: BY10527_R AGTGGCTCACGCCTGTAATC
Reviews

Customers who bought this product also purchased
FGC45218
FGC45218
M215
M215
M34
M34
Y6198
Y6198
V22
V22
BY104490
BY104490
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies