Top » Catalog » SNPs » Z62

$18.00

Z62
[Z62]

Z62
hg38 Position: ChrY:13504861..13504861
Ancestral: C
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a1
Comments: I1. parallel to L22. downstream of Z60. Z61
Forward Primer: Z62v2_F AACTGCTGGGAGATCCATTG
Reverse Primer: Z62v2_R TGGACATAAAATTCTTGGTTGATG
Reviews

Customers who bought this product also purchased
A11152
A11152
S26062
S26062
A14608
A14608
FGC23806
FGC23806
M253
M253
Y25790
Y25790
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies