Top » Catalog » SNPs » FGC15560

$18.00

FGC15560
[FGC15560]

FGC15560
hg38 Position: ChrY:21167078..21167078
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I1a (unlisted)
Comments: Below DF29
Forward Primer: FGC15560_F TGTTGAAGGATGTCAGCAAG
Reverse Primer: FGC15560_R GATGATAGCCCTGTGTTAGCC
Reviews

Customers who bought this product also purchased
Z138
Z138
S10908
S10908
Z63
Z63
Y14628
Y14628
A14157
A14157
Z59
Z59
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies