Top » Catalog » SNPs » FGC15560

$18.00

FGC15560
[FGC15560]

FGC15560
hg38 Position: ChrY:21167078..21167078
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: I1a (unlisted)
Comments: Below DF29
Forward Primer: FGC15560_F TGTTGAAGGATGTCAGCAAG
Reverse Primer: FGC15560_R GATGATAGCCCTGTGTTAGCC
Reviews

Customers who bought this product also purchased
Y18697
Y18697
S10066
S10066
DF29
DF29
Y11205
Y11205
Z2336
Z2336
Z138
Z138
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies