Top » Catalog » SNPs » S6402

$18.00

S6402
[S6402]

S6402
hg38 Position: ChrY:20775274..20775274
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2b
Comments: Below Z138 > S2293 > S6277 > S6270 > S20289 > S6397
Forward Primer: S6402_F TGCGTTGTTTTTCTGATTTTG
Reverse Primer: S6402_R CTCCAGGCTAGGTGACACAG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A6397
A6397
Z140
Z140
A6549
A6549
Z2539
Z2539
S6270
S6270
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies