Top » Catalog » SNPs » Y11772

$18.00

Y11772
[Y11772]

Y11772
HG19 Position: ChrY:23199414..23199414
Ancestral: G
Derived: T
Reference: Yfull (2015)
ISOGG Haplogroup: I2a
Comments: Downstream of PF4135
Forward Primer: Y11772_F GACCTTGTGCAAGGCAAAAC
Reverse Primer: Y11772_R GCCATCTGGATGTGTACGTG
Reviews

Customers who bought this product also purchased
A11374
A11374
A13664
A13664
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies