Top » Catalog » SNPs » A14769

$18.00

A14769
[A14769]

A14769
hg38 Position: ChrY:13861814..13861814
Ancestral: C
Derived: T
Reference: Wayne KAUFFMAN (2017)
ISOGG Haplogroup: R1b
Comments: Below Z326
Forward Primer: A14769v2_F CCTTTGACAGTGGCTCTGAATAC
Reverse Primer: A14769v2_R GACTCTCACTCTTATCAAGGAAAGC
Reviews

Customers who bought this product also purchased
A14767
A14767
DNA Sample Kit
DNA Sample Kit
A14768
A14768
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies