Top » Catalog » SNPs » Y28536

$15.00

Y28536
[Y28536]

Y28536
hg38 Position: ChrY:20671530..20671530
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: N1c (not listed)
Comments: Below CTS10760
Forward Primer: Y28536_F AGGAGATACAGGCAGGAGACC
Reverse Primer: Y28536_R AACTAGCTGGGCATGTTGATG
Reviews

Customers who bought this product also purchased
L395
L395
N Superclade Panel
N Superclade Panel
P298
P298
Y16323
Y16323
L1026
L1026
Z1936
Z1936
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies