Top » Catalog » SNPs » Y28536

$18.00

Y28536
[Y28536]

Y28536
hg38 Position: ChrY:20671530..20671530
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: N1c (not listed)
Comments: Below CTS10760
Forward Primer: Y28536_F AGGAGATACAGGCAGGAGACC
Reverse Primer: Y28536_R AACTAGCTGGGCATGTTGATG
Reviews

Customers who bought this product also purchased
Y87014
Y87014
N1a-VL29 Panel
N1a-VL29 Panel
Z16980
Z16980
Y24076
Y24076
L1025
L1025
BY158
BY158
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies