Top » Catalog » SNPs » Y28536

$18.00

Y28536
[Y28536]

Y28536
hg38 Position: ChrY:20671530..20671530
Ancestral: A
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: N1c (not listed)
Comments: Below CTS10760
Forward Primer: Y28536_F AGGAGATACAGGCAGGAGACC
Reverse Primer: Y28536_R AACTAGCTGGGCATGTTGATG
Reviews

Customers who bought this product also purchased
Y155153
Y155153
Y5004
Y5004
A17625
A17625
Y14150
Y14150
L550
L550
Z16974
Z16974
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies