Top » Catalog » SNPs » A14776

$18.00

A14776
[A14776]

A14776
hg38 Position: ChrY:10064886..10064886
Ancestral: C
Derived: T
Reference: Sergey Leonov (2017)
ISOGG Haplogroup: R1a (not listed)
Comments: Below Y18348
Forward Primer: A14776_F TGAGGAAGAAGCCCAGTCAG
Reverse Primer: A14776_R AGTGGGGCAGTAGATTGGTG
Reviews

Customers who bought this product also purchased
YP417
YP417
A14777
A14777
YP619
YP619
YP6047
YP6047
L1029
L1029
Y18348
Y18348
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies