Top » Catalog » SNPs » VL72

$18.00

VL72
[VL72]

VL72
hg38 Position: ChrY:14239738..14239738
Ancestral: G
Derived: T
Reference: Vladimir Volkov (2016)
ISOGG Haplogroup: N
Comments: Below VL62
Forward Primer: VL72_F CTCACTGACAGCACAACAGATG
Reverse Primer: VL72_R AGCTGGCAGTCAGGAATGTC
Reviews

Customers who bought this product also purchased
Z1936
Z1936
CTS4329
CTS4329
Z5033
Z5033
Y31922
Y31922
VL62
VL62
BY30470
BY30470
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies