Top » Catalog » SNPs » VL72

$18.00

VL72
[VL72]

VL72
hg38 Position: ChrY:14239738..14239738
Ancestral: G
Derived: T
Reference: Vladimir Volkov (2016)
ISOGG Haplogroup: N
Comments: Below VL62
Forward Primer: VL72_F CTCACTGACAGCACAACAGATG
Reverse Primer: VL72_R AGCTGGCAGTCAGGAATGTC
Reviews

Customers who bought this product also purchased
CTS4329
CTS4329
Z1936
Z1936
N1a-Z1936 Panel
N1a-Z1936 Panel
Y20915
Y20915
Z1939
Z1939
Z1941
Z1941
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies