Top » Catalog » SNPs » Z5033

$18.00

Z5033
[Z5033]

Z5033
hg38 Position: ChrY:21303459..21303459
Ancestral: G
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: N (not listed)
Comments: under Z1940
Forward Primer: Z5033_F GTGGATTTACAATCCTTGAGCTAC
Reverse Primer: Z5033_R AGAAGAGGTGCCATGTCCTG
Reviews

Customers who bought this product also purchased
BY30470
BY30470
Y20915
Y20915
VL60
VL60
VL72
VL72
Y17790
Y17790
Y31922
Y31922
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies