Top » Catalog » SNPs » Y17790

$18.00

Y17790
[Y17790]

Y17790
hg38 Position: ChrY:8793144..8793144
Ancestral: A
Derived: G
Reference: YFull (2015)
ISOGG Haplogroup: N
Comments: Below VL62
Forward Primer: Y17790_F AATATGCAGAAGAGTAAAACTAGACTCG
Reverse Primer: Y17790_R GGCCACTTGTATGTTTTCTTCC
Reviews

Customers who bought this product also purchased
YSEQ-XTD
YSEQ-XTD
DYS459
DYS459
DYF399X
DYF399X
DYS464X
DYS464X
VL60
VL60
VL72
VL72
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies