Top » Catalog » SNPs » Y23527

$18.00

Y23527
[Y23527]

Y23527
hg38 Position: ChrY:18926146..18926146
Ancestral: T
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: I1a1b3 (unlisted)
Comments: .
Forward Primer: Y23527_F TGTGTCCTCCTCCCTCTCTC
Reverse Primer: Y23527_R GAGAATTCACCCTAATTGGATTTG
Reviews

Customers who bought this product also purchased
Y18928
Y18928
PH159
PH159
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
Y5483
Y5483
Y20037
Y20037
L813
L813
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies