Top » Catalog » SNPs » Y5483

$18.00

Y5483
[Y5483]

Y5483
hg38 Position: ChrY:16481803..16481803
Ancestral: A
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: I1a1b3 (unlisted)
Comments: .
Forward Primer: Y5483_F GGGTTTTGCGATATTGTTCG
Reverse Primer: Y5483_R TAATACGCTTCTTTTTCCCTGTC
Reviews

Customers who bought this product also purchased
BY47860
BY47860
Y5474
Y5474
Y20037
Y20037
Y23527
Y23527
Y19675
Y19675
PH159
PH159
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies