Top » Catalog » SNPs » A14798

$18.00

A14798
[A14798]

A14798
hg38 Position: ChrY:7689965..7689965
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2017) Big Y
ISOGG Haplogroup: I2a
Comments: Below S17250 > A5875
Forward Primer: A14798_F AGCCATGTGCCCTAAATGAC
Reverse Primer: A14798_R ATGAGAGGCCCTTTGGAATG
Reviews

Customers who bought this product also purchased
BY153567
BY153567
A22770
A22770
Y162454
Y162454
Y13338
Y13338
A1328
A1328
A13912
A13912
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies