Top » Catalog » SNPs » A14799

$18.00

A14799
[A14799]

A14799
hg38 Position: ChrY:8690899..8690899
Ancestral: A
Derived: T
Reference: Zdenko Markovic (2017) Big Y
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A14799_F ACAATGCCACACACACACAG
Reverse Primer: A14799_R AGGCTGGCTCTTCCTGTACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies