Top » Catalog » SNPs » A14794

$18.00

A14794
[A14794]

A14794
hg38 Position: ChrY:15060825..15060825
Ancestral: G
Derived: A
Reference: Floyd Owsley (2017)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of BY4140 and BY4141
Forward Primer: A14794_F CGGGATGTGTTCAGATAGCC
Reverse Primer: A14794_R TGGCAATTTAAAGAATTTGATGC
Reviews

Customers who bought this product also purchased
A14793
A14793
R1b-BY4140 Owsley Panel
R1b-BY4140 Owsley Panel
BY4141
BY4141
A14797
A14797
A14796
A14796
A14795
A14795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies