Top » Catalog » SNPs » Z2914

$18.00

Z2914
[Z2914]

Z2914
hg38 Position: ChrY:12406889..12406889
Ancestral: T
Derived: G
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1a (not listed)
Comments: Below M458
Forward Primer: Z2914_F AGCCGAGATGGTATCACTGC
Reverse Primer: Z2914_R GGATGACAGGTGTGAGCCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies