Top » Catalog » SNPs » Y17798

$18.00

Y17798
[Y17798]

Y17798
hg38 Position: ChrY:13437639..13437639
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: N
Comments: Below Z5893
Forward Primer: Y17798_F CCAATGGCTAGAAAACAATGC
Reverse Primer: Y17798_R AGTTCCTCCATGCCTCTTTG
Reviews

Customers who bought this product also purchased
Z5893
Z5893
Y29762
Y29762
CTS4329
CTS4329
Y23184
Y23184
VL62
VL62
Y24161
Y24161
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies