Top » Catalog » SNPs » Y19097

$18.00

Y19097
[Y19097]

Y19097
hg38 Position: ChrY:14982040..14982040
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: N
Comments: Below CTS4329
Forward Primer: Y19097_F GGCAGGTGATTAGATTGTGTCTG
Reverse Primer: Y19097_R GGTGAAAGAACATAGGCTAGACAGAC
Reviews

Customers who bought this product also purchased
CTS4329
CTS4329
FT5789
FT5789
PH521
PH521
BY18114
BY18114
N1a-Z1936 Panel
N1a-Z1936 Panel
BY194138
BY194138
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies