Top » Catalog » SNPs » L296

$18.00

L296
[L296]

L296
hg38 Position: ChrY:19578303..19578303
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a1b3a1a
Comments: Found in a I-L22 WTY participant
Forward Primer: L296_F TATCTGGCTGTGCCCAGTG
Reverse Primer: L296_R AAGCCAGTATGCTGTCTCTGC
Reviews

Customers who bought this product also purchased
P109
P109
BY35379
BY35379
L287
L287
Y51801
Y51801
S335
S335
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies