Top » Catalog » SNPs » L296

$18.00

L296
[L296]

L296
hg38 Position: ChrY:19578303..19578303
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a1b3a1a
Comments: Found in a I-L22 WTY participant
Forward Primer: L296_F TATCTGGCTGTGCCCAGTG
Reverse Primer: L296_R AAGCCAGTATGCTGTCTCTGC
Reviews

Customers who bought this product also purchased
Y8598
Y8598
Y5476
Y5476
BY35406
BY35406
Z2045
Z2045
Y23449
Y23449
CTS2208
CTS2208
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies