Top » Catalog » SNPs » Y10990

$18.00

Y10990
[Y10990]

Y10990
hg38 Position: ChrY:12590557..12590557
Ancestral: C
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: I-Y8954
Comments: Below Z133
Forward Primer: Y10990_F AAAAACAAGGGATCAGCAATG
Reverse Primer: Y10990_R CTCAGGAAAAACTTGCCTCTC
Reviews

Customers who bought this product also purchased
L258
L258
Y105581
Y105581
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
Y36521
Y36521
Z133
Z133
Y13389
Y13389
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies