Top » Catalog » SNPs » Y15027

$18.00

Y15027
[Y15027]

Y15027
hg38 Position: ChrY:13804323..13804323
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: I1a1b3a1 (unlisted)
Comments: Below L258>Y8598
Forward Primer: Y15027_F GCCTTGCTGAGAGACAGGAG
Reverse Primer: Y15027_R GCAGTAGTGGAGGGTCAGTG
Reviews

Customers who bought this product also purchased
Y20288
Y20288
Y51801
Y51801
Y13389
Y13389
P109
P109
Y13391
Y13391
L287
L287
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies