Top » Catalog » SNPs » Y15027

$18.00

Y15027
[Y15027]

Y15027
hg38 Position: ChrY:13804323..13804323
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: I1a1b3a1 (unlisted)
Comments: Below L258>Y8598
Forward Primer: Y15027_F GCCTTGCTGAGAGACAGGAG
Reverse Primer: Y15027_R GCAGTAGTGGAGGGTCAGTG
Reviews

Customers who bought this product also purchased
S335
S335
L296
L296
Y5476
Y5476
Z2045
Z2045
Y8598
Y8598
CTS2208
CTS2208
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies