Top » Catalog » SNPs » Y15027

$18.00

Y15027
[Y15027]

Y15027
hg38 Position: ChrY:13804323..13804323
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: I1a1b3a1 (unlisted)
Comments: Below L258>Y8598
Forward Primer: Y15027_F GCCTTGCTGAGAGACAGGAG
Reverse Primer: Y15027_R GCAGTAGTGGAGGGTCAGTG
Reviews

Customers who bought this product also purchased
CTS2208
CTS2208
BY35406
BY35406
Z133
Z133
Y23449
Y23449
CTS6868
CTS6868
Y98743
Y98743
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies