Top » Catalog » SNPs » Y15027

$18.00

Y15027
[Y15027]

Y15027
hg38 Position: ChrY:13804323..13804323
Ancestral: T
Derived: C
Reference: YFull (2015)
ISOGG Haplogroup: I1a1b3a1 (unlisted)
Comments: Below L258>Y8598
Forward Primer: Y15027_F GCCTTGCTGAGAGACAGGAG
Reverse Primer: Y15027_R GCAGTAGTGGAGGGTCAGTG
Reviews

Customers who bought this product also purchased
Y142122
Y142122
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
Y34547
Y34547
Z721
Z721
BY92112
BY92112
S335
S335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies