Top » Catalog » SNPs » Y23449

$18.00

Y23449
[Y23449]

Y23449
hg38 Position: ChrY:19705224..19705224
Ancestral: C
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: I1a1b3a1 (unlisted)
Comments: Below L258
Forward Primer: Y23449_F TTGTGTCAGTGCAACTTAATCAG
Reverse Primer: Y23449_R AACAGTAGCATGGGTCAACG
Reviews

Customers who bought this product also purchased
L287
L287
BY157356
BY157356
S335
S335
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
Y34547
Y34547
Z721
Z721
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies