Top » Catalog » SNPs » Y23449

$18.00

Y23449
[Y23449]

Y23449
hg38 Position: ChrY:19705224..19705224
Ancestral: C
Derived: G
Reference: YFull (2016)
ISOGG Haplogroup: I1a1b3a1 (unlisted)
Comments: Below L258
Forward Primer: Y23449_F TTGTGTCAGTGCAACTTAATCAG
Reverse Primer: Y23449_R AACAGTAGCATGGGTCAACG
Reviews

Customers who bought this product also purchased
Y15027
Y15027
L296
L296
Y5476
Y5476
BY35406
BY35406
Z2045
Z2045
Y8598
Y8598
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies