Top » Catalog » SNPs » Z133

$18.00

Z133
[Z133]

Z133
hg38 Position: ChrY:13022400..13022400
Ancestral: A
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: not listed
Comments: downstream of I-L258
Forward Primer: Z133_F TTGCGAGATTGTGTGTCTCC
Reverse Primer: Z133_R GGCCAAGCTGAGGTAAGAATC
Reviews

Customers who bought this product also purchased
Y34547
Y34547
CTS2208
CTS2208
Y15027
Y15027
L296
L296
CTS6868
CTS6868
Z2045
Z2045
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies