Top » Catalog » SNPs » PF4189

$18.00

PF4189
[PF4189]

PF4189
hg38 Position: ChrY:16998664..16998664
Ancestral: C
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: I2a1a1a1a1a
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF4189_F ACACATGGGAATTCCTGGAC
Reverse Primer: PF4189_R TGAACGCGTCATCCAAATAG
Reviews

Customers who bought this product also purchased
PF4421
PF4421
Y104389
Y104389
PF4193
PF4193
PF4435
PF4435
PF4294
PF4294
Z26930
Z26930
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies