Top » Catalog » SNPs » A658

$18.00

A658
[A658]

A658
hg38 Position: ChrY:20437100..20437100
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A658_F CTAAGTTGAAAATCTTCTGCAGAGC
Reverse Primer: A658_R CACACCGTTACCAGCATCTATC
Reviews

Customers who bought this product also purchased
A649
A649
A656
A656
A655
A655
A654
A654
A653
A653
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies