Top » Catalog » SNPs » L803

$18.00

L803
[L803]

L803
hg38 Position: ChrY:15487654..15487654
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a2a1d1
Comments: Found in a hg I-M253 WTY participant
Forward Primer: L803v2_F ACCATCTATACTCACTATGGAAACAG
Reverse Primer: L803v2_R TTGGGAAATTACAGAAAGAAAAGG
Reviews

Customers who bought this product also purchased
I1-Z2539 (including L1302) Panel
I1-Z2539 (including L1302) Panel
S4715
S4715
Z2041
Z2041
L1248
L1248
Z140
Z140
L573
L573
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies