Top » Catalog » SNPs » L803

$18.00

L803
[L803]

L803
hg38 Position: ChrY:15487654..15487654
Ancestral: T
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a2a1d1
Comments: Found in a hg I-M253 WTY participant
Forward Primer: L803v2_F ACCATCTATACTCACTATGGAAACAG
Reverse Primer: L803v2_R TTGGGAAATTACAGAAAGAAAAGG
Reviews

Customers who bought this product also purchased
S4715
S4715
Z2041
Z2041
L1248
L1248
Z140
Z140
L573
L573
FGC22162
FGC22162
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies