Top » Catalog » SNPs » S11132

$18.00

S11132
[S11132]

S11132
hg38 Position: ChrY:8334777..8334777
Ancestral: A
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2a1 (unlisted)
Comments: Below Z2539>L1248
Forward Primer: S11132_F CTGGCTCAGCACCTTGATG
Reverse Primer: S11132_R TCATGGCTCAAATGTCATTAAAC
Reviews

Customers who bought this product also purchased
Z2041
Z2041
L1248
L1248
Z140
Z140
L573
L573
FGC22162
FGC22162
Z2539
Z2539
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies