Top » Catalog » SNPs » S11132

$15.00

S11132
[S11132]

S11132
hg38 Position: ChrY:8334777..8334777
Ancestral: A
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2a1 (unlisted)
Comments: Below Z2539>L1248
Forward Primer: S11132_F CTGGCTCAGCACCTTGATG
Reverse Primer: S11132_R TCATGGCTCAAATGTCATTAAAC
Reviews

Customers who bought this product also purchased
S244
S244
Z73
Z73
Y21567
Y21567
I1 Superclade Panel
I1 Superclade Panel
I1-Z2539 (including L1302) Panel
I1-Z2539 (including L1302) Panel
S4715
S4715
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies