Top » Catalog » SNPs » Y25790

$18.00

Y25790
[Y25790]

Y25790
hg38 Position: ChrY:19554065..19554065
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: I1a2a1b (unlisted)
Comments: Below Z73
Forward Primer: Y25790_F TGGAAAACCTTGTTTGGTTAGG
Reverse Primer: Y25790_R GCCCAGGAAAGTATGATTGG
Reviews

Customers who bought this product also purchased
Z59
Z59
I1-Z2539 (including L1302) Panel
I1-Z2539 (including L1302) Panel
Z2900
Z2900
I1 Superclade Panel
I1 Superclade Panel
Z62
Z62
BY232
BY232
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies