Top » Catalog » SNPs » Y25790

$18.00

Y25790
[Y25790]

Y25790
hg38 Position: ChrY:19554065..19554065
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: I1a2a1b (unlisted)
Comments: Below Z73
Forward Primer: Y25790_F TGGAAAACCTTGTTTGGTTAGG
Reverse Primer: Y25790_R GCCCAGGAAAGTATGATTGG
Reviews

Customers who bought this product also purchased
Z2539
Z2539
S2122
S2122
Z140
Z140
Z73
Z73
Z2041
Z2041
L1302
L1302
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies