Top » Catalog » SNPs » Y25790

$18.00

Y25790
[Y25790]

Y25790
hg38 Position: ChrY:19554065..19554065
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: I1a2a1b (unlisted)
Comments: Below Z73
Forward Primer: Y25790_F TGGAAAACCTTGTTTGGTTAGG
Reverse Primer: Y25790_R GCCCAGGAAAGTATGATTGG
Reviews

Customers who bought this product also purchased
L1302
L1302
BY479
BY479
Z59
Z59
I1-Z2539 (including L1302) Panel
I1-Z2539 (including L1302) Panel
Z2900
Z2900
I1 Superclade Panel
I1 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies